3-5- ارزیابی خواص ضدمیکروبی آنتی بیوتیک ها برباکتری های SRB مثبت
اثر ضدمیکروبی آنتی بیوتیکها برروی نمونه های مثبت SRB در مرحله قبل مورد بررسی قرارگرفت. برای این منظور به ازای هر نمونه مثبت 6 محیط کشت API درنظر گرفته شد. شیشه اول فاقد تلقیح باکتریایی (No inoculation)، شیشه دوم یک سی سی از شیشه مثبت تلقیح گردید ولی آنتی بیوتیک به آن اضافه نشد (کنترل منفی) و در شیشههای شماره 3 تا 6 یک سی سی نمونه مثبت به 1 سی سی از هر کدام از آنتی بیوتیکهای مورد بررسی به صورت جداگانه تلقیح و 2 ماه در حرارت 35 درجه گرماگذاری گردید.

شکل 3-3: تاثیر آنتی بیوتیک ها بر رشد باکتری های SRB
3-6- تعیین هویت مولکولی باکتری های SRB مثبت
استخراج DNA: برای این منظور، ابتدا سویه های باکتریایی به مدت 24 ساعت بر روی محیط LB کشت داده شدند. سپس DNA باکتری با استفاده از کیت (Molecular Biological, Iran System Transfer) و مطابق با دستورالعمل شرکت سازنده استخراج گردید.
PCR ژن16S rRNA : در این مطالعه به منظور تکثیر ناحیه 16S rRNA باکتری SRB از پرایمرهای عمومی 16ss 8F: (5`- AGAGTTTGATCCTGGCTCAG -3`) و 16ss 1492R: (5`- GGTTACCTTGTTACGACTT – 3`)
استفاده گردید. واکنشPCR با حجم نهایی 25 میکرولیتر شامل: 10 نانوگرم در میکرولیتر DNA الگو، 4/0 میکرومولار از هر پرایمر، 2/0 میکرومولارdNTP ، 2 میکرومولار MgCl2، 5/2 میکرولیتر بافر PCR و 1 واحد آنزیم Taq DNA Polymerase انجام گردید. در ادامه واکنش PCR در دستگاه ترموسایکلر (Thermal Cycler PeQLab Primus 25-United Kingdom) با شرایط دمایی 5 دقیقه واسرشت شدن ابتدایی در دمای 94 درجه سانتی گراد و در ادامه 35 چرخه شامل واسرشت شدن در دمای 94 درجه سانتی گراد به مدت 1 دقیقه، اتصال در دمای 45 درجه سانتی گراد به مدت 30 ثانیه، طویل شدن در دمای 72 درجه سانتی گراد به مدت 90 ثانیه و در نهایت طویل شدن نهایی در دمای 72 درجه سانتی گراد به مدت 5 دقیقه انجام شد. در نهایت محصول PCR به ژل آگاروز 1 درصد واجد اتیدیوم برماید منتقل و به مدت 1 ساعت در ولتاژ 80 ولت الکتروفورز گردید (Sambrook and Russell 2001, 245-29).
تخلیص محصول PCR: باند bp1400 از ژل آگاروز مطابق با دستورالعمل کیت فرمنتاز (K0513) استخراج و جهت تعیین توالی برای توالییابی توسط شرکت ماهان ژن به شرکت Bioneer کره جنوبی فرستاده شد. نتایج حاصل از تعیین توالی در بانکهای ژنی بلاست شده و همولوژی آنها بررسی گردید. قرابت بالاتر از 98 درصد به عنوان جنس و گونه باکتری مجهول در نظر گرفته شد (Sambrook and Russell 2001, 245-29).
3-7- آنالیز آماری
دادههای این پژوهش با استفاده از نسخه شانزدهم نرم افزار SPSSوMicrosofte office 2007) Excel) و آزمونهای آنالیز واریانس و مربع کای و در صورت معنا دار شدن با استفاده از ضریب همبستگی مورد آنالیز قرار گرفت. سطح معنی داری P<0.05 در نظر گرفته شد.

مطلب مرتبط :   پایان نامه ارشد رایگان درباره عوامل مؤثر بر افزایش بهره وری نیروی انسانی و عوامل مؤثر بر افزایش بهره وری
فصل چهارم:
نتایج یافته های تحقیق

4-1- مقدمه
در ابتدا، نتایج حاصل از تحلیل داده‌ها ارائه می‌گردد. در تجزیه و تحلیل داده‌ها، ابتدا با استفاده از جدول‌های فراوانی و نمودارهای میله‌ای (ستونی) توصیفی از برخی ویژگی‌های جمعیت شناختی ارائه می‌گردد. سپس تجزیه و تحلیل نتایج با استفاده از جدول توافق (مجذور کای) انجام شده و در صورت معنا دار شدن ضریب همبستگی نیز محاسبه گردیده و به همراه جداول و نمودارها ارائه گردیده است.
4-2- تجزیه و تحلیل نتایج جمعیت شناختی
یافته های حاصل از ویژگیهای دموگرافیک (جمعیتی) پرسشنامه در جداول و نمودارهای مربوطه ارائه شده است.
4-2-1 جنسیت
از بین 50 نفر از افرادی که مورد بررسی قرار گرفتند، 28 نفر (56% ) مونث، 22نفر (44%) مذکر میباشند و مقدار معناداری برابر با 396/0 میباشد که در سطح 05/0 نشان دهنده معنادار نشدن متغییر جنسیت میباشد (جدول و نمودار 4-1).
جدول 4-1: توزیع فراوانی و افراد بر حسب جنسیت
جنسیت فراوانی درصد فراوانی
مونث 28 56
مذکر 22 44
جمع 50 100
همانطور که در جدول مشخص است56% از افراد مونث میباشند.